B6;129-Gt(ROSA)26Sortm9(CAG-GFP*)Nat/J

Cat. No.: CEMM-07250583

This reduced recombination, nuclear-localized GFP reporter strain (R26 mLSL-nGFP) enables extremely sparse cre-mediated labeling of cells and is appropriate for applications such as lineage tracing.
Inquiry
Status Live Mouse
Frozen Embryo
Age 4 weeks
12 weeks
Customized Age
Sex Male
Female
GENETICS
Allele Symbol
Gt(ROSA)26Sortm9(CAG-GFP*)Nat
show more close
Allele Name
targeted mutation 9
show more close
Allele Attributes
Conditional ready (e.g. floxed); Reporter
show more close
Gene Symbol
Gt(ROSA)26Sor
show more close
Gene Name
gene trap ROSA 26
show more close
Chromosome
6
show more close
Expressed Genes
GFP, Green Fluorescent Protein
show more close
MGI Accession ID show more close
Site of Expression
Upon induction with 4-hydroxyTamoxifen (4HT) GFP is observed in Cre-expressing tissues.
show more close
Strain of Origin
129
show more close
Molecular Note
The targeting vector containins (from 5' to 3') a CAG promoter, a mutant loxP63 (ATAACTTCGTATAGCCTACATTATACGAAGTTAT)-triple poly A/stop-wild type loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT), a nuclear-localized GFP with a C-terminal 6-myc epitope tag, a bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette. The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences.
show more close
HUSBANDRY
Suggested Controls
Wild-type from the colony
show more close
Breeding Considerations
Heterozygotes and homozygotes are viable and fertile.
show more close
For Research Use Only.
Related Products