B6;129-Gt(ROSA)26Sortm7(CAG-tdTomato*)Nat/J

Cat. No.: CEMM-07250584

This reduced recombination, nuclear-localized tdTomato reporter strain (R26 mLSL-ntdT) enables extremely sparse cre-mediated labeling of cells and is appropriate for applications such as lineage tracing.
Inquiry
Status Live Mouse
Frozen Embryo
Age 4 weeks
12 weeks
Customized Age
Sex Male
Female
GENETICS
Allele Symbol
Gt(ROSA)26Sortm7(CAG-tdTomato*)Nat
show more close
Allele Name
targeted mutation 7
show more close
Allele Attributes
Conditional ready (e.g. floxed); Reporter
show more close
Gene Symbol
Gt(ROSA)26Sor
show more close
Gene Name
gene trap ROSA 26
show more close
Chromosome
6
show more close
Expressed Genes
RFP, Red Fluorescent Protein, coral
show more close
MGI Accession ID show more close
Site of Expression
tdTomato is expressed in Cre expressing tissues after Cre recombination.
show more close
Strain of Origin
129
show more close
Molecular Note
The targeting vector contains (from 5' to 3') a CAG promoter, a mutant loxP63(ATAACTTCGTATAGCCTACATTATACGAAGTTAT)-triple poly A/stop-wild type loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT), a nuclear-localized tdTomato with a C-terminal triple hemaglutinin (HA) epitope, an bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette. The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences.
show more close
HUSBANDRY
Suggested Controls
Wild-type from the colony
show more close
Breeding Considerations
Homozygotes and heterozygotes are viable and fertile.
show more close
For Research Use Only.
Related Products