C57BL/6J-Gt(ROSA)26Sorem1Naik/J

Cat. No.: CEMM-07251125

Common Name: LoxCode
LoxCode knock-in mice have the LoxCode cassette inserted into the endogenous Gt(ROSA)26Sor locus. The LoxCode cassette is composed of 14 loxP sites in alternating orientation flanking 13 small (8-14nts) code elements. Upon Cre exposure, random recombination between the loxP sites lead to inversions and excisions, resulting in DNA sequence reshuffling with a theoretical DNA diversity of over 30 billion barcodes. This is an inducible, cellular barcoding technology based on the Cre-loxP system that allows for sensitive, high diversity lineage tracing at the cellular, spatial, and tissue level.
Inquiry
Status Live Mouse
Frozen Embryo
Age 4 weeks
12 weeks
Customized Age
Sex Male
Female
GENETICS
Allele Symbol
Gt(ROSA)26Sorem1Naik
show more close
Allele Name
endonuclease-mediated mutation 1
show more close
Allele Attributes
Conditional ready (e.g. floxed)
show more close
Gene Symbol
Gt(ROSA)26Sor
show more close
Gene Name
gene trap ROSA 26
show more close
Chromosome
6
show more close
MGI Accession ID show more close
Strain of Origin
C57BL/6J
show more close
Molecular Note
Plasmids encoding a guide RNA (CTCCAGTCTTTCTAGAAGAT) are designed to insert the LoxCode cassette into the endogenous Gt(ROSA)26Sor locus. The LoxCode cassette is composed of 14 loxP sites in alternating orientation flanking 13 small (8-14nts) code elements. Upon Cre exposure, random recombination between the loxP sites lead to inversions and excisions, resulting in DNA sequence reshuffling with a theoretical DNA diversity of over 30 billion barcodes.
show more close
HUSBANDRY
Suggested Controls
C57BL/6J
show more close
Breeding Considerations
Although homozygous mice are viable and fertile, the donating investigator suggests breeding heterozygous females with homozygous males when maintaining a colony. First generation homozygous females are fertile with fertility decreasing if colony is kept as homozygous for a few generations.
show more close
For Research Use Only.
Related Products