Products

Online Inquiry

B6.Cg-Igs7tm175(tetO-EGFP/RNAi:Pou5f1, CAG-tdTomato, -tTA2)Tasic/J

Cat. No.: CEMM-07250977

Common Name: Ai175 [or Ai175(TIT2L-EGFP-shOct4-ICL-tdT-tTA2]
Ai175 (also called Ai175(TIT2L-EGFP-shOct4-ICL-tdT-tTA2)) is a Cre-dependent, Tet-controllable transcription tool strain with dual fluorescent reporters, created by targeted insertion at the Igs7 locus (TIGRE). Exposure to Cre recombinase removes both STOP cassettes, resulting in tTA2 expression, robust tdTomato fluorescence and EGFP/shOct4 fusion protein expression (robust EGFP fluorescence and potential knockdown of endogenous Pou5f1 expression by short hairpin RNA shOct4). The EGFP/shOct4 expression may be expected to be diminished/eliminated by doxycycline.
Inquiry
Status Live Mouse
Frozen Embryo
Age 4 weeks
12 weeks
Customized Age
Sex Male
Female
GENETICS
Allele Symbol
Igs7tm175(tetO-EGFP/RNAi:Pou5f1,CAG-tdTomato,-tTA2)Tasic
show more close
Allele Name
targeted mutation 175
show more close
Allele Attributes
Conditional ready (e.g. floxed); Reporter; Inducible; Transactivator
show more close
Gene Symbol
Igs7
show more close
Gene Name
intergenic site 7
show more close
Chromosome
9
show more close
MGI Accession ID
6514371
show more close
Strain of Origin
(129S6/SvEvTac x C57BL/6NCrl)F1
show more close
Molecular Note
The vector is designed with (from 5' to 3') an FRT3 site, two copies of chicken beta-globin HS4 insulator element (to reduce reporter gene expression in absence of transactivators), a Tet response element/promoter (TRE2; details below), a loxP-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-PGKpA), an EGFP/RNAi:Pou5f1 fusion protein (described below), a woodchuck hepatitis virus post-transcriptional regulatory element, a BGH polyA, two copies of chicken beta-globin HS4 insulator element, a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter, a lox2272-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-TKpA), a tdTomato sequence, a viral 2A oligopeptide), a synthetic modified tetracycline-regulated transactivator gene (tTA2(S)), a WPRE, a BGH polyA, an AttB site, a PGK-5'hygro cassette, an RNA splice donor, a FRT5 site, SA, 3'hygro, SV40pA, and AttP. The TRE2 promoter used here is Tet-responsive P>hCMV*-1min CMVhCMV*-1< is silent in the absence of tTA or rtTA binding to tetO.The EGFP/RNAi:Pouf5f1 fusion protein is composed of a synthetic enhanced green fluorescent protein sequence (EGFP), an ~140bp linker sequence and a 121bp short hairpin RNA sequence (gaaggtatattgctgttgacagtgagcgacagaaggagctag aacagttttagtgaagccacagatgtaaaactgttctagctccttctgctgcctactgcctcggacttcaaggggctag) designed to target/silence the mouse octamer-binding transcription factor 4 encoding locus (Pou5f1).
show more close
HUSBANDRY
Suggested Controls
C57BL/6J
show more close
Breeding Considerations
Heterozygous mice are viable and fertile with no reported gross physical or behavioral abnormalities. To date, it has not been attempted to make this strain homozygous. When maintaining a live colony, heterozygous mice may be bred together, to wildtype mice from the colony or to C57BL/6J inbred mice.
show more close
Breeding Strategy
Wild-type x Heterozygote; Heterozygote x Wild-type
show more close
For Research Use Only.
Related Products