Products

Online Inquiry

C57BL/6J-Rbpjem2Lutzy/J

Cat. No.: CEMM-07250981

Common Name: Rbpjflox
Rbpjflox is a CRISPR/Cas9-generated mutant of the recombination signal binding protein for immunoglobulin kappa J region gene with loxP sites flanking exon 4. Exposure to Cre recombinase deletes the floxed sequence, creating a null allele. This may be useful for Cre-lox studies of NOTCH signaling and T cell development.
Inquiry
Status Live Mouse
Frozen Embryo
Age 4 weeks
12 weeks
Customized Age
Sex Male
Female
GENETICS
Allele Symbol
Rbpjem2Lutzy
show more close
Allele Name
endonuclease-mediated mutation 2
show more close
Allele Attributes
Conditional ready (e.g. floxed)
show more close
Gene Symbol
Rbpj
show more close
Gene Name
recombination signal binding protein for immunoglobulin kappa J region
show more close
Chromosome
5
show more close
MGI Accession ID
6503833
show more close
Strain of Origin
C57BL/6J
show more close
Molecular Note
CRISPR/Cas9 genome editing is used to insert loxP sites on either side of exon 4. A double stranded oligonucleotide donor DNA with a 1.6-kb left arm, a 1.1-kb right arm, two loxP sequence elements [with the sequence ATAACTTCGTATAGCATACATTATACGAAGTTAT] and all of exon 4 is used to generate the floxed allele. The 5' loxP sequence is positioned 211nt 5' of exon 4 and the 3' loxP sequence is positioned 170nt 3' of exon 4. Progeny were sCreened by DNA sequencing to identify correctly targeted pups.
show more close
HUSBANDRY
Suggested Controls
C57BL/6J
show more close
Breeding Considerations
Both heterozygous and homozygous mice are viable and fertile. When maintaining a live colony, homozygous mice may be bred together.
show more close
Breeding Strategy
Homozygote x Homozygote
show more close
For Research Use Only.
Related Products